ID: 913972001

View in Genome Browser
Species Human (GRCh38)
Location 1:143423094-143423116
Sequence CCCCAGGGAGGGGGTAGTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913971983_913972001 19 Left 913971983 1:143423052-143423074 CCATCAGCAGGCCCCTTGGTTGT No data
Right 913972001 1:143423094-143423116 CCCCAGGGAGGGGGTAGTCCGGG No data
913971982_913972001 20 Left 913971982 1:143423051-143423073 CCCATCAGCAGGCCCCTTGGTTG No data
Right 913972001 1:143423094-143423116 CCCCAGGGAGGGGGTAGTCCGGG No data
913971980_913972001 22 Left 913971980 1:143423049-143423071 CCCCCATCAGCAGGCCCCTTGGT No data
Right 913972001 1:143423094-143423116 CCCCAGGGAGGGGGTAGTCCGGG No data
913971981_913972001 21 Left 913971981 1:143423050-143423072 CCCCATCAGCAGGCCCCTTGGTT No data
Right 913972001 1:143423094-143423116 CCCCAGGGAGGGGGTAGTCCGGG No data
913971986_913972001 7 Left 913971986 1:143423064-143423086 CCCTTGGTTGTGCCACAGGCAGG No data
Right 913972001 1:143423094-143423116 CCCCAGGGAGGGGGTAGTCCGGG No data
913971985_913972001 8 Left 913971985 1:143423063-143423085 CCCCTTGGTTGTGCCACAGGCAG No data
Right 913972001 1:143423094-143423116 CCCCAGGGAGGGGGTAGTCCGGG No data
913971988_913972001 6 Left 913971988 1:143423065-143423087 CCTTGGTTGTGCCACAGGCAGGG No data
Right 913972001 1:143423094-143423116 CCCCAGGGAGGGGGTAGTCCGGG No data
913971991_913972001 -5 Left 913971991 1:143423076-143423098 CCACAGGCAGGGGTCCTGCCCCA No data
Right 913972001 1:143423094-143423116 CCCCAGGGAGGGGGTAGTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913972001 Original CRISPR CCCCAGGGAGGGGGTAGTCC GGG Intergenic
No off target data available for this crispr