ID: 913972004

View in Genome Browser
Species Human (GRCh38)
Location 1:143423096-143423118
Sequence CCCCCGGACTACCCCCTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913972004_913972008 -8 Left 913972004 1:143423096-143423118 CCAGGGAGGGGGTAGTCCGGGGG No data
Right 913972008 1:143423111-143423133 TCCGGGGGAGCTCGAGGGTGTGG No data
913972004_913972011 19 Left 913972004 1:143423096-143423118 CCAGGGAGGGGGTAGTCCGGGGG No data
Right 913972011 1:143423138-143423160 GGCCAGCTGTCACTCCTCCCTGG No data
913972004_913972010 -2 Left 913972004 1:143423096-143423118 CCAGGGAGGGGGTAGTCCGGGGG No data
Right 913972010 1:143423117-143423139 GGAGCTCGAGGGTGTGGCACAGG No data
913972004_913972013 24 Left 913972004 1:143423096-143423118 CCAGGGAGGGGGTAGTCCGGGGG No data
Right 913972013 1:143423143-143423165 GCTGTCACTCCTCCCTGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913972004 Original CRISPR CCCCCGGACTACCCCCTCCC TGG (reversed) Intergenic
No off target data available for this crispr