ID: 913972006

View in Genome Browser
Species Human (GRCh38)
Location 1:143423105-143423127
Sequence GGGTAGTCCGGGGGAGCTCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913971983_913972006 30 Left 913971983 1:143423052-143423074 CCATCAGCAGGCCCCTTGGTTGT No data
Right 913972006 1:143423105-143423127 GGGTAGTCCGGGGGAGCTCGAGG No data
913971998_913972006 -8 Left 913971998 1:143423090-143423112 CCTGCCCCAGGGAGGGGGTAGTC No data
Right 913972006 1:143423105-143423127 GGGTAGTCCGGGGGAGCTCGAGG No data
913971986_913972006 18 Left 913971986 1:143423064-143423086 CCCTTGGTTGTGCCACAGGCAGG No data
Right 913972006 1:143423105-143423127 GGGTAGTCCGGGGGAGCTCGAGG No data
913971985_913972006 19 Left 913971985 1:143423063-143423085 CCCCTTGGTTGTGCCACAGGCAG No data
Right 913972006 1:143423105-143423127 GGGTAGTCCGGGGGAGCTCGAGG No data
913971991_913972006 6 Left 913971991 1:143423076-143423098 CCACAGGCAGGGGTCCTGCCCCA No data
Right 913972006 1:143423105-143423127 GGGTAGTCCGGGGGAGCTCGAGG No data
913971988_913972006 17 Left 913971988 1:143423065-143423087 CCTTGGTTGTGCCACAGGCAGGG No data
Right 913972006 1:143423105-143423127 GGGTAGTCCGGGGGAGCTCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913972006 Original CRISPR GGGTAGTCCGGGGGAGCTCG AGG Intergenic
No off target data available for this crispr