ID: 913972007

View in Genome Browser
Species Human (GRCh38)
Location 1:143423106-143423128
Sequence GGTAGTCCGGGGGAGCTCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913971991_913972007 7 Left 913971991 1:143423076-143423098 CCACAGGCAGGGGTCCTGCCCCA No data
Right 913972007 1:143423106-143423128 GGTAGTCCGGGGGAGCTCGAGGG No data
913971986_913972007 19 Left 913971986 1:143423064-143423086 CCCTTGGTTGTGCCACAGGCAGG No data
Right 913972007 1:143423106-143423128 GGTAGTCCGGGGGAGCTCGAGGG No data
913971998_913972007 -7 Left 913971998 1:143423090-143423112 CCTGCCCCAGGGAGGGGGTAGTC No data
Right 913972007 1:143423106-143423128 GGTAGTCCGGGGGAGCTCGAGGG No data
913971988_913972007 18 Left 913971988 1:143423065-143423087 CCTTGGTTGTGCCACAGGCAGGG No data
Right 913972007 1:143423106-143423128 GGTAGTCCGGGGGAGCTCGAGGG No data
913971985_913972007 20 Left 913971985 1:143423063-143423085 CCCCTTGGTTGTGCCACAGGCAG No data
Right 913972007 1:143423106-143423128 GGTAGTCCGGGGGAGCTCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913972007 Original CRISPR GGTAGTCCGGGGGAGCTCGA GGG Intergenic
No off target data available for this crispr