ID: 913972008

View in Genome Browser
Species Human (GRCh38)
Location 1:143423111-143423133
Sequence TCCGGGGGAGCTCGAGGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913972002_913972008 -7 Left 913972002 1:143423095-143423117 CCCAGGGAGGGGGTAGTCCGGGG No data
Right 913972008 1:143423111-143423133 TCCGGGGGAGCTCGAGGGTGTGG No data
913972000_913972008 -6 Left 913972000 1:143423094-143423116 CCCCAGGGAGGGGGTAGTCCGGG No data
Right 913972008 1:143423111-143423133 TCCGGGGGAGCTCGAGGGTGTGG No data
913971991_913972008 12 Left 913971991 1:143423076-143423098 CCACAGGCAGGGGTCCTGCCCCA No data
Right 913972008 1:143423111-143423133 TCCGGGGGAGCTCGAGGGTGTGG No data
913971985_913972008 25 Left 913971985 1:143423063-143423085 CCCCTTGGTTGTGCCACAGGCAG No data
Right 913972008 1:143423111-143423133 TCCGGGGGAGCTCGAGGGTGTGG No data
913971986_913972008 24 Left 913971986 1:143423064-143423086 CCCTTGGTTGTGCCACAGGCAGG No data
Right 913972008 1:143423111-143423133 TCCGGGGGAGCTCGAGGGTGTGG No data
913971988_913972008 23 Left 913971988 1:143423065-143423087 CCTTGGTTGTGCCACAGGCAGGG No data
Right 913972008 1:143423111-143423133 TCCGGGGGAGCTCGAGGGTGTGG No data
913971998_913972008 -2 Left 913971998 1:143423090-143423112 CCTGCCCCAGGGAGGGGGTAGTC No data
Right 913972008 1:143423111-143423133 TCCGGGGGAGCTCGAGGGTGTGG No data
913972004_913972008 -8 Left 913972004 1:143423096-143423118 CCAGGGAGGGGGTAGTCCGGGGG No data
Right 913972008 1:143423111-143423133 TCCGGGGGAGCTCGAGGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913972008 Original CRISPR TCCGGGGGAGCTCGAGGGTG TGG Intergenic
No off target data available for this crispr