ID: 913972010

View in Genome Browser
Species Human (GRCh38)
Location 1:143423117-143423139
Sequence GGAGCTCGAGGGTGTGGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913971991_913972010 18 Left 913971991 1:143423076-143423098 CCACAGGCAGGGGTCCTGCCCCA No data
Right 913972010 1:143423117-143423139 GGAGCTCGAGGGTGTGGCACAGG No data
913972004_913972010 -2 Left 913972004 1:143423096-143423118 CCAGGGAGGGGGTAGTCCGGGGG No data
Right 913972010 1:143423117-143423139 GGAGCTCGAGGGTGTGGCACAGG No data
913972000_913972010 0 Left 913972000 1:143423094-143423116 CCCCAGGGAGGGGGTAGTCCGGG No data
Right 913972010 1:143423117-143423139 GGAGCTCGAGGGTGTGGCACAGG No data
913971988_913972010 29 Left 913971988 1:143423065-143423087 CCTTGGTTGTGCCACAGGCAGGG No data
Right 913972010 1:143423117-143423139 GGAGCTCGAGGGTGTGGCACAGG No data
913971998_913972010 4 Left 913971998 1:143423090-143423112 CCTGCCCCAGGGAGGGGGTAGTC No data
Right 913972010 1:143423117-143423139 GGAGCTCGAGGGTGTGGCACAGG No data
913971986_913972010 30 Left 913971986 1:143423064-143423086 CCCTTGGTTGTGCCACAGGCAGG No data
Right 913972010 1:143423117-143423139 GGAGCTCGAGGGTGTGGCACAGG No data
913972002_913972010 -1 Left 913972002 1:143423095-143423117 CCCAGGGAGGGGGTAGTCCGGGG No data
Right 913972010 1:143423117-143423139 GGAGCTCGAGGGTGTGGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913972010 Original CRISPR GGAGCTCGAGGGTGTGGCAC AGG Intergenic
No off target data available for this crispr