ID: 913975122

View in Genome Browser
Species Human (GRCh38)
Location 1:143449849-143449871
Sequence CAGGATTTCCTCCCTGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913975122_913975130 17 Left 913975122 1:143449849-143449871 CCCTCTCCAGGGAGGAAATCCTG No data
Right 913975130 1:143449889-143449911 GATGCTGTAGATGCGCGTGTAGG 0: 1
1: 4
2: 1
3: 5
4: 46
913975122_913975127 -7 Left 913975122 1:143449849-143449871 CCCTCTCCAGGGAGGAAATCCTG No data
Right 913975127 1:143449865-143449887 AATCCTGCGGATCTGCACCTGGG No data
913975122_913975126 -8 Left 913975122 1:143449849-143449871 CCCTCTCCAGGGAGGAAATCCTG No data
Right 913975126 1:143449864-143449886 AAATCCTGCGGATCTGCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913975122 Original CRISPR CAGGATTTCCTCCCTGGAGA GGG (reversed) Intergenic