ID: 913975125 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:143449855-143449877 |
Sequence | GATCCGCAGGATTTCCTCCC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
913975125_913975131 | 26 | Left | 913975125 | 1:143449855-143449877 | CCAGGGAGGAAATCCTGCGGATC | No data | ||
Right | 913975131 | 1:143449904-143449926 | CGTGTAGGTCACGATCATGATGG | No data | ||||
913975125_913975130 | 11 | Left | 913975125 | 1:143449855-143449877 | CCAGGGAGGAAATCCTGCGGATC | No data | ||
Right | 913975130 | 1:143449889-143449911 | GATGCTGTAGATGCGCGTGTAGG | 0: 1 1: 4 2: 1 3: 5 4: 46 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
913975125 | Original CRISPR | GATCCGCAGGATTTCCTCCC TGG (reversed) | Intergenic | ||