ID: 913975125

View in Genome Browser
Species Human (GRCh38)
Location 1:143449855-143449877
Sequence GATCCGCAGGATTTCCTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913975125_913975131 26 Left 913975125 1:143449855-143449877 CCAGGGAGGAAATCCTGCGGATC No data
Right 913975131 1:143449904-143449926 CGTGTAGGTCACGATCATGATGG No data
913975125_913975130 11 Left 913975125 1:143449855-143449877 CCAGGGAGGAAATCCTGCGGATC No data
Right 913975130 1:143449889-143449911 GATGCTGTAGATGCGCGTGTAGG 0: 1
1: 4
2: 1
3: 5
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913975125 Original CRISPR GATCCGCAGGATTTCCTCCC TGG (reversed) Intergenic