ID: 913975128

View in Genome Browser
Species Human (GRCh38)
Location 1:143449868-143449890
Sequence TCGCCCAGGTGCAGATCCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913975128_913975133 20 Left 913975128 1:143449868-143449890 CCTGCGGATCTGCACCTGGGCGA No data
Right 913975133 1:143449911-143449933 GTCACGATCATGATGGCCATGGG No data
913975128_913975131 13 Left 913975128 1:143449868-143449890 CCTGCGGATCTGCACCTGGGCGA No data
Right 913975131 1:143449904-143449926 CGTGTAGGTCACGATCATGATGG No data
913975128_913975134 21 Left 913975128 1:143449868-143449890 CCTGCGGATCTGCACCTGGGCGA No data
Right 913975134 1:143449912-143449934 TCACGATCATGATGGCCATGGGG No data
913975128_913975132 19 Left 913975128 1:143449868-143449890 CCTGCGGATCTGCACCTGGGCGA No data
Right 913975132 1:143449910-143449932 GGTCACGATCATGATGGCCATGG No data
913975128_913975130 -2 Left 913975128 1:143449868-143449890 CCTGCGGATCTGCACCTGGGCGA No data
Right 913975130 1:143449889-143449911 GATGCTGTAGATGCGCGTGTAGG 0: 1
1: 4
2: 1
3: 5
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913975128 Original CRISPR TCGCCCAGGTGCAGATCCGC AGG (reversed) Intergenic