ID: 913975129 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:143449882-143449904 |
Sequence | GCGCATCTACAGCATCGCCC AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 53 | |||
Summary | {0: 1, 1: 4, 2: 1, 3: 0, 4: 47} |
Found 5 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
913975129_913975133 | 6 | Left | 913975129 | 1:143449882-143449904 | CCTGGGCGATGCTGTAGATGCGC | 0: 1 1: 4 2: 1 3: 0 4: 47 |
||
Right | 913975133 | 1:143449911-143449933 | GTCACGATCATGATGGCCATGGG | No data | ||||
913975129_913975134 | 7 | Left | 913975129 | 1:143449882-143449904 | CCTGGGCGATGCTGTAGATGCGC | 0: 1 1: 4 2: 1 3: 0 4: 47 |
||
Right | 913975134 | 1:143449912-143449934 | TCACGATCATGATGGCCATGGGG | No data | ||||
913975129_913975132 | 5 | Left | 913975129 | 1:143449882-143449904 | CCTGGGCGATGCTGTAGATGCGC | 0: 1 1: 4 2: 1 3: 0 4: 47 |
||
Right | 913975132 | 1:143449910-143449932 | GGTCACGATCATGATGGCCATGG | No data | ||||
913975129_913975136 | 29 | Left | 913975129 | 1:143449882-143449904 | CCTGGGCGATGCTGTAGATGCGC | 0: 1 1: 4 2: 1 3: 0 4: 47 |
||
Right | 913975136 | 1:143449934-143449956 | GATGTAGAAGCTGATGAGCGAGG | No data | ||||
913975129_913975131 | -1 | Left | 913975129 | 1:143449882-143449904 | CCTGGGCGATGCTGTAGATGCGC | 0: 1 1: 4 2: 1 3: 0 4: 47 |
||
Right | 913975131 | 1:143449904-143449926 | CGTGTAGGTCACGATCATGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
913975129 | Original CRISPR | GCGCATCTACAGCATCGCCC AGG (reversed) | Intergenic | ||