ID: 913975129

View in Genome Browser
Species Human (GRCh38)
Location 1:143449882-143449904
Sequence GCGCATCTACAGCATCGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 4, 2: 1, 3: 0, 4: 47}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913975129_913975133 6 Left 913975129 1:143449882-143449904 CCTGGGCGATGCTGTAGATGCGC 0: 1
1: 4
2: 1
3: 0
4: 47
Right 913975133 1:143449911-143449933 GTCACGATCATGATGGCCATGGG No data
913975129_913975134 7 Left 913975129 1:143449882-143449904 CCTGGGCGATGCTGTAGATGCGC 0: 1
1: 4
2: 1
3: 0
4: 47
Right 913975134 1:143449912-143449934 TCACGATCATGATGGCCATGGGG No data
913975129_913975132 5 Left 913975129 1:143449882-143449904 CCTGGGCGATGCTGTAGATGCGC 0: 1
1: 4
2: 1
3: 0
4: 47
Right 913975132 1:143449910-143449932 GGTCACGATCATGATGGCCATGG No data
913975129_913975136 29 Left 913975129 1:143449882-143449904 CCTGGGCGATGCTGTAGATGCGC 0: 1
1: 4
2: 1
3: 0
4: 47
Right 913975136 1:143449934-143449956 GATGTAGAAGCTGATGAGCGAGG No data
913975129_913975131 -1 Left 913975129 1:143449882-143449904 CCTGGGCGATGCTGTAGATGCGC 0: 1
1: 4
2: 1
3: 0
4: 47
Right 913975131 1:143449904-143449926 CGTGTAGGTCACGATCATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913975129 Original CRISPR GCGCATCTACAGCATCGCCC AGG (reversed) Intergenic