ID: 913975130

View in Genome Browser
Species Human (GRCh38)
Location 1:143449889-143449911
Sequence GATGCTGTAGATGCGCGTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 4, 2: 1, 3: 5, 4: 46}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913975122_913975130 17 Left 913975122 1:143449849-143449871 CCCTCTCCAGGGAGGAAATCCTG No data
Right 913975130 1:143449889-143449911 GATGCTGTAGATGCGCGTGTAGG 0: 1
1: 4
2: 1
3: 5
4: 46
913975123_913975130 16 Left 913975123 1:143449850-143449872 CCTCTCCAGGGAGGAAATCCTGC No data
Right 913975130 1:143449889-143449911 GATGCTGTAGATGCGCGTGTAGG 0: 1
1: 4
2: 1
3: 5
4: 46
913975125_913975130 11 Left 913975125 1:143449855-143449877 CCAGGGAGGAAATCCTGCGGATC No data
Right 913975130 1:143449889-143449911 GATGCTGTAGATGCGCGTGTAGG 0: 1
1: 4
2: 1
3: 5
4: 46
913975128_913975130 -2 Left 913975128 1:143449868-143449890 CCTGCGGATCTGCACCTGGGCGA No data
Right 913975130 1:143449889-143449911 GATGCTGTAGATGCGCGTGTAGG 0: 1
1: 4
2: 1
3: 5
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913975130 Original CRISPR GATGCTGTAGATGCGCGTGT AGG Intergenic