ID: 913975131

View in Genome Browser
Species Human (GRCh38)
Location 1:143449904-143449926
Sequence CGTGTAGGTCACGATCATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913975129_913975131 -1 Left 913975129 1:143449882-143449904 CCTGGGCGATGCTGTAGATGCGC 0: 1
1: 4
2: 1
3: 0
4: 47
Right 913975131 1:143449904-143449926 CGTGTAGGTCACGATCATGATGG No data
913975128_913975131 13 Left 913975128 1:143449868-143449890 CCTGCGGATCTGCACCTGGGCGA No data
Right 913975131 1:143449904-143449926 CGTGTAGGTCACGATCATGATGG No data
913975125_913975131 26 Left 913975125 1:143449855-143449877 CCAGGGAGGAAATCCTGCGGATC No data
Right 913975131 1:143449904-143449926 CGTGTAGGTCACGATCATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913975131 Original CRISPR CGTGTAGGTCACGATCATGA TGG Intergenic