ID: 913975131 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:143449904-143449926 |
| Sequence | CGTGTAGGTCACGATCATGA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 913975129_913975131 | -1 | Left | 913975129 | 1:143449882-143449904 | CCTGGGCGATGCTGTAGATGCGC | 0: 1 1: 4 2: 1 3: 0 4: 47 |
||
| Right | 913975131 | 1:143449904-143449926 | CGTGTAGGTCACGATCATGATGG | No data | ||||
| 913975128_913975131 | 13 | Left | 913975128 | 1:143449868-143449890 | CCTGCGGATCTGCACCTGGGCGA | No data | ||
| Right | 913975131 | 1:143449904-143449926 | CGTGTAGGTCACGATCATGATGG | No data | ||||
| 913975125_913975131 | 26 | Left | 913975125 | 1:143449855-143449877 | CCAGGGAGGAAATCCTGCGGATC | No data | ||
| Right | 913975131 | 1:143449904-143449926 | CGTGTAGGTCACGATCATGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 913975131 | Original CRISPR | CGTGTAGGTCACGATCATGA TGG | Intergenic | ||