ID: 913975132

View in Genome Browser
Species Human (GRCh38)
Location 1:143449910-143449932
Sequence GGTCACGATCATGATGGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913975128_913975132 19 Left 913975128 1:143449868-143449890 CCTGCGGATCTGCACCTGGGCGA No data
Right 913975132 1:143449910-143449932 GGTCACGATCATGATGGCCATGG No data
913975129_913975132 5 Left 913975129 1:143449882-143449904 CCTGGGCGATGCTGTAGATGCGC 0: 1
1: 4
2: 1
3: 0
4: 47
Right 913975132 1:143449910-143449932 GGTCACGATCATGATGGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913975132 Original CRISPR GGTCACGATCATGATGGCCA TGG Intergenic