ID: 913975133

View in Genome Browser
Species Human (GRCh38)
Location 1:143449911-143449933
Sequence GTCACGATCATGATGGCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913975129_913975133 6 Left 913975129 1:143449882-143449904 CCTGGGCGATGCTGTAGATGCGC 0: 1
1: 4
2: 1
3: 0
4: 47
Right 913975133 1:143449911-143449933 GTCACGATCATGATGGCCATGGG No data
913975128_913975133 20 Left 913975128 1:143449868-143449890 CCTGCGGATCTGCACCTGGGCGA No data
Right 913975133 1:143449911-143449933 GTCACGATCATGATGGCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913975133 Original CRISPR GTCACGATCATGATGGCCAT GGG Intergenic