ID: 913981341

View in Genome Browser
Species Human (GRCh38)
Location 1:143520030-143520052
Sequence CAGAGGACAGTGAAGTGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913981335_913981341 29 Left 913981335 1:143519978-143520000 CCAAAAAATTAACTAGAGTCTTG No data
Right 913981341 1:143520030-143520052 CAGAGGACAGTGAAGTGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913981341 Original CRISPR CAGAGGACAGTGAAGTGGCC AGG Intergenic
No off target data available for this crispr