ID: 913984855

View in Genome Browser
Species Human (GRCh38)
Location 1:143555625-143555647
Sequence GGTCAGACTGCAGCACAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913984849_913984855 4 Left 913984849 1:143555598-143555620 CCATTTCAGTGGGCCTTGCCGCT No data
Right 913984855 1:143555625-143555647 GGTCAGACTGCAGCACAAGCTGG No data
913984851_913984855 -9 Left 913984851 1:143555611-143555633 CCTTGCCGCTCCCTGGTCAGACT No data
Right 913984855 1:143555625-143555647 GGTCAGACTGCAGCACAAGCTGG No data
913984847_913984855 9 Left 913984847 1:143555593-143555615 CCCTGCCATTTCAGTGGGCCTTG No data
Right 913984855 1:143555625-143555647 GGTCAGACTGCAGCACAAGCTGG No data
913984848_913984855 8 Left 913984848 1:143555594-143555616 CCTGCCATTTCAGTGGGCCTTGC No data
Right 913984855 1:143555625-143555647 GGTCAGACTGCAGCACAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913984855 Original CRISPR GGTCAGACTGCAGCACAAGC TGG Intergenic
No off target data available for this crispr