ID: 913986622

View in Genome Browser
Species Human (GRCh38)
Location 1:143571444-143571466
Sequence CTGAATGAGCTTTTGGTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913986618_913986622 -9 Left 913986618 1:143571430-143571452 CCGGAAGTCTGCCTCTGAATGAG No data
Right 913986622 1:143571444-143571466 CTGAATGAGCTTTTGGTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913986622 Original CRISPR CTGAATGAGCTTTTGGTAGA GGG Intergenic
No off target data available for this crispr