ID: 913986982

View in Genome Browser
Species Human (GRCh38)
Location 1:143574640-143574662
Sequence AGAGAGAATCTAATGGCTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913986972_913986982 9 Left 913986972 1:143574608-143574630 CCTCTCCCCCAACCACAGGAAAT No data
Right 913986982 1:143574640-143574662 AGAGAGAATCTAATGGCTTGGGG No data
913986976_913986982 1 Left 913986976 1:143574616-143574638 CCAACCACAGGAAATGCATCTCC No data
Right 913986982 1:143574640-143574662 AGAGAGAATCTAATGGCTTGGGG No data
913986977_913986982 -3 Left 913986977 1:143574620-143574642 CCACAGGAAATGCATCTCCGAGA No data
Right 913986982 1:143574640-143574662 AGAGAGAATCTAATGGCTTGGGG No data
913986975_913986982 2 Left 913986975 1:143574615-143574637 CCCAACCACAGGAAATGCATCTC No data
Right 913986982 1:143574640-143574662 AGAGAGAATCTAATGGCTTGGGG No data
913986970_913986982 18 Left 913986970 1:143574599-143574621 CCTATGACACCTCTCCCCCAACC No data
Right 913986982 1:143574640-143574662 AGAGAGAATCTAATGGCTTGGGG No data
913986973_913986982 4 Left 913986973 1:143574613-143574635 CCCCCAACCACAGGAAATGCATC No data
Right 913986982 1:143574640-143574662 AGAGAGAATCTAATGGCTTGGGG No data
913986974_913986982 3 Left 913986974 1:143574614-143574636 CCCCAACCACAGGAAATGCATCT No data
Right 913986982 1:143574640-143574662 AGAGAGAATCTAATGGCTTGGGG No data
913986969_913986982 24 Left 913986969 1:143574593-143574615 CCATTGCCTATGACACCTCTCCC No data
Right 913986982 1:143574640-143574662 AGAGAGAATCTAATGGCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913986982 Original CRISPR AGAGAGAATCTAATGGCTTG GGG Intergenic
No off target data available for this crispr