ID: 913995948

View in Genome Browser
Species Human (GRCh38)
Location 1:143652107-143652129
Sequence TCTGCGATTTCCCCACAAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913995948_913995952 1 Left 913995948 1:143652107-143652129 CCCGCTTGTGGGGAAATCGCAGA No data
Right 913995952 1:143652131-143652153 CCAGTGCAGCCGCAGTGCGGTGG No data
913995948_913995950 -2 Left 913995948 1:143652107-143652129 CCCGCTTGTGGGGAAATCGCAGA No data
Right 913995950 1:143652128-143652150 GAGCCAGTGCAGCCGCAGTGCGG No data
913995948_913995954 17 Left 913995948 1:143652107-143652129 CCCGCTTGTGGGGAAATCGCAGA No data
Right 913995954 1:143652147-143652169 GCGGTGGACTAGCCTCATCCAGG No data
913995948_913995955 18 Left 913995948 1:143652107-143652129 CCCGCTTGTGGGGAAATCGCAGA No data
Right 913995955 1:143652148-143652170 CGGTGGACTAGCCTCATCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913995948 Original CRISPR TCTGCGATTTCCCCACAAGC GGG (reversed) Intergenic
No off target data available for this crispr