ID: 913996599

View in Genome Browser
Species Human (GRCh38)
Location 1:143655909-143655931
Sequence CTGAAGACACAGTGGGAAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913996599_913996611 25 Left 913996599 1:143655909-143655931 CCGTCTTCCCACTGTGTCTTCAG No data
Right 913996611 1:143655957-143655979 CTCTAGTGTCCCTTTTATGGGGG No data
913996599_913996608 22 Left 913996599 1:143655909-143655931 CCGTCTTCCCACTGTGTCTTCAG No data
Right 913996608 1:143655954-143655976 GCTCTCTAGTGTCCCTTTTATGG No data
913996599_913996609 23 Left 913996599 1:143655909-143655931 CCGTCTTCCCACTGTGTCTTCAG No data
Right 913996609 1:143655955-143655977 CTCTCTAGTGTCCCTTTTATGGG No data
913996599_913996604 -9 Left 913996599 1:143655909-143655931 CCGTCTTCCCACTGTGTCTTCAG No data
Right 913996604 1:143655923-143655945 TGTCTTCAGGTGGCTGAAAGAGG No data
913996599_913996605 -8 Left 913996599 1:143655909-143655931 CCGTCTTCCCACTGTGTCTTCAG No data
Right 913996605 1:143655924-143655946 GTCTTCAGGTGGCTGAAAGAGGG No data
913996599_913996606 -7 Left 913996599 1:143655909-143655931 CCGTCTTCCCACTGTGTCTTCAG No data
Right 913996606 1:143655925-143655947 TCTTCAGGTGGCTGAAAGAGGGG No data
913996599_913996610 24 Left 913996599 1:143655909-143655931 CCGTCTTCCCACTGTGTCTTCAG No data
Right 913996610 1:143655956-143655978 TCTCTAGTGTCCCTTTTATGGGG No data
913996599_913996607 -6 Left 913996599 1:143655909-143655931 CCGTCTTCCCACTGTGTCTTCAG No data
Right 913996607 1:143655926-143655948 CTTCAGGTGGCTGAAAGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913996599 Original CRISPR CTGAAGACACAGTGGGAAGA CGG (reversed) Intergenic
No off target data available for this crispr