ID: 914003139

View in Genome Browser
Species Human (GRCh38)
Location 1:143709598-143709620
Sequence CACCTTTAGAAACATCAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914003139_914003142 30 Left 914003139 1:143709598-143709620 CCCAGCTGATGTTTCTAAAGGTG No data
Right 914003142 1:143709651-143709673 AGCTTGATTTCCCATAATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914003139 Original CRISPR CACCTTTAGAAACATCAGCT GGG (reversed) Intergenic
No off target data available for this crispr