ID: 914003295

View in Genome Browser
Species Human (GRCh38)
Location 1:143710760-143710782
Sequence GCTTATCAGGAGAGAATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914003295_914003301 16 Left 914003295 1:143710760-143710782 CCTTCCATTCTCTCCTGATAAGC No data
Right 914003301 1:143710799-143710821 CCAGTTTCAGCCATGTTACAGGG No data
914003295_914003299 15 Left 914003295 1:143710760-143710782 CCTTCCATTCTCTCCTGATAAGC No data
Right 914003299 1:143710798-143710820 GCCAGTTTCAGCCATGTTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914003295 Original CRISPR GCTTATCAGGAGAGAATGGA AGG (reversed) Intergenic
No off target data available for this crispr