ID: 914007752

View in Genome Browser
Species Human (GRCh38)
Location 1:143747734-143747756
Sequence GGGAGCTGACCAAATTGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 137}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914007746_914007752 21 Left 914007746 1:143747690-143747712 CCTTATAGAATCTGTGCTGGAGG No data
Right 914007752 1:143747734-143747756 GGGAGCTGACCAAATTGCCAAGG 0: 1
1: 0
2: 0
3: 7
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914007752 Original CRISPR GGGAGCTGACCAAATTGCCA AGG Intergenic
901042551 1:6374231-6374253 GGGAGGTGGCCAAATGGCCCTGG + Intronic
901887950 1:12237296-12237318 GGGATCTCACCATATTGCCCAGG - Intronic
902563734 1:17295966-17295988 GCCTGCTGACCAAATGGCCAGGG + Intergenic
902668874 1:17958237-17958259 GGGAGCTGACCACCTCACCAGGG - Intergenic
904593566 1:31628765-31628787 GGGAGGTGACCAGGATGCCAAGG + Intronic
905703742 1:40039397-40039419 GGAAGCTGAATAACTTGCCAAGG - Intergenic
905823156 1:41009753-41009775 GGGACCTGGCCAATATGCCAGGG - Intronic
906216716 1:44045368-44045390 GTGTGCTGTCCAAAGTGCCAGGG - Intergenic
908536059 1:65078432-65078454 GGGATCTCACCATATTGCCCAGG - Intergenic
910307143 1:85778293-85778315 GGGATCTCACTATATTGCCAAGG + Intronic
913656617 1:120966478-120966500 GGGAGCTGGCCGAATTGCCGAGG + Intergenic
914007752 1:143747734-143747756 GGGAGCTGACCAAATTGCCAAGG + Intergenic
914521169 1:148417726-148417748 GGGAGCTGGCCGAATTGCCGAGG + Intergenic
914646580 1:149658215-149658237 GGGAGCTGGCCGAATTGCCGAGG + Intergenic
915599592 1:156913924-156913946 GGGACCTGCCCAGCTTGCCAGGG + Exonic
918981408 1:191564740-191564762 GAGTGGTGTCCAAATTGCCATGG + Intergenic
920200791 1:204258620-204258642 TGGAGCTGCCCAAATCCCCAGGG + Intronic
921008097 1:211113788-211113810 GTGAGCTGACCTTATAGCCAAGG + Intronic
921070992 1:211657188-211657210 TGGAGGTGGCCAAACTGCCATGG + Intergenic
924629531 1:245723988-245724010 CGGAGATGACCAAGTTCCCAGGG + Intergenic
1063127065 10:3144609-3144631 GGGAGCTCACTACATTGCCCAGG - Intronic
1066243910 10:33563495-33563517 GGGACCTGACCAACTTGCACAGG + Intergenic
1067836521 10:49644900-49644922 GGGAGCTGTCCACATGCCCAAGG + Intronic
1068266457 10:54656443-54656465 GGGAATTTTCCAAATTGCCACGG - Intronic
1073729692 10:106273276-106273298 GGGGGCTGATGAAATAGCCAAGG + Intergenic
1075489415 10:122853696-122853718 GGGGTCTCACCATATTGCCAAGG - Intronic
1079407449 11:20158812-20158834 AGGAGCTGACCAATTGGTCATGG + Intronic
1079790652 11:24734840-24734862 GGGATGTGACCAAATGGCAATGG - Intronic
1080937013 11:36874814-36874836 GGGAGCTGGCAAAATTTACAGGG + Intergenic
1081807701 11:45899476-45899498 GGGATCTGTCCAAGGTGCCAGGG + Intronic
1085763931 11:79265877-79265899 GGGAGCTGAGACAGTTGCCATGG - Intronic
1087782889 11:102319721-102319743 GGGAGCTGAGCCTATTGCTAAGG + Intronic
1088420519 11:109640287-109640309 GGGAGCTGACTAAAATGACCAGG + Intergenic
1089081055 11:115776578-115776600 GGCAGCAGACAATATTGCCAAGG + Intergenic
1091165023 11:133467975-133467997 TAGAGGTGACAAAATTGCCAAGG - Intronic
1093697137 12:22173382-22173404 GGAATTTGAACAAATTGCCAAGG + Intronic
1094839966 12:34338758-34338780 GGGTGCTGCCCAAAGTGGCAGGG + Intergenic
1094840093 12:34339238-34339260 GGGAGCTGCCCAAAGTGGCAGGG + Intergenic
1102923434 12:116809562-116809584 GGGAACTGACCATCTTGGCATGG - Intronic
1103687499 12:122743641-122743663 GGGAGCTGGCTATGTTGCCAGGG + Intergenic
1106691132 13:32117922-32117944 GGGAGCTGCCCAAAGTCACATGG - Intronic
1108044621 13:46372004-46372026 GGGAGGTGGCCAAAATCCCAGGG + Exonic
1110048664 13:70864430-70864452 GGGTTCTGGCCAAATTGTCAAGG + Intergenic
1112287291 13:98115546-98115568 GGGAGGTGATCAACTTGCCCAGG - Intergenic
1117042666 14:51780935-51780957 GGGAGCTGTCCAAGGTGTCACGG + Intergenic
1117380536 14:55157952-55157974 GGGATCTCACTAAATTGCCCAGG + Intronic
1121607651 14:95253091-95253113 TGGAGTTTGCCAAATTGCCAAGG - Intronic
1124203474 15:27698104-27698126 GGGAGCTGCCCATTTTGCCTGGG - Intergenic
1129936291 15:79453006-79453028 GGGGGCTGAGCAAACTGCCCTGG - Intronic
1135265431 16:21021603-21021625 GGGAGCAGAAAAAATAGCCAAGG + Intronic
1142397076 16:89838206-89838228 GGGATCTTACCACATTGCCCAGG + Intronic
1145764700 17:27450415-27450437 GAGAGCTGAAAAATTTGCCAAGG + Intergenic
1145885339 17:28378297-28378319 GGGAGCTGCCCACACTTCCATGG - Intronic
1149804744 17:59605768-59605790 GGGATCTCACCACATTGCCCAGG - Intronic
1150548136 17:66184055-66184077 GGGGTCTCACCAAATTGCCCAGG - Intronic
1152151173 17:78602339-78602361 GGGAGCTGAGCCAAATGCCTCGG - Intergenic
1153697126 18:7655246-7655268 GGGATCTCACCAAGTTGCCCAGG + Intronic
1160201959 18:76803040-76803062 GGAAGGTGACATAATTGCCAAGG + Intronic
1161271232 19:3390429-3390451 GGGAGCTGAACAGAGTGTCAGGG + Intronic
1161292401 19:3501765-3501787 GGGGGCTTACCACATTGCCCAGG - Intergenic
1165160998 19:33816230-33816252 GGGGTCTCACCAAATTGCCCAGG - Intergenic
1166065023 19:40352769-40352791 GGGATCTCACCACATTGCCCAGG - Intronic
1166885610 19:45959313-45959335 GGGGGCTGACCACATGTCCAGGG + Intronic
925663873 2:6232215-6232237 GGCAGCTGCCCAAACTGCTAGGG - Intergenic
929031122 2:37650699-37650721 GGGAGCAGACAGAATTCCCAGGG - Intronic
929534307 2:42770875-42770897 AGAAGCTGAGCAATTTGCCAAGG + Intronic
930117824 2:47733980-47734002 GTCAGCTTACCACATTGCCATGG + Intronic
931704763 2:64938118-64938140 GGGCTCTGACCAGAGTGCCAGGG + Intergenic
936714055 2:115163218-115163240 GGGAGCTGTCCAAATCGCCCAGG + Intronic
941754520 2:169170729-169170751 GTGAGCTGACCATAGTGCCCTGG + Intronic
943685741 2:190816226-190816248 GGGATCTCACCATATTGCCCAGG + Intergenic
948715110 2:239856162-239856184 TGGAGCTGACCAGAGTGTCAGGG - Intergenic
1173430506 20:42983413-42983435 GGAAGCTGAGCAACTTCCCAAGG + Intronic
1174081628 20:47974155-47974177 GGGAGCTGCCCAACCAGCCAGGG - Intergenic
1174386075 20:50189391-50189413 GGGAGCTGCCCCAATGGCCTAGG + Intergenic
1182164926 22:28163431-28163453 GGGAGCTGTGTATATTGCCATGG - Exonic
1182704695 22:32269801-32269823 GGGAGATGACCATCTTGTCATGG - Intergenic
1182941347 22:34280472-34280494 GAGAGATGACAAAATTGCTAGGG - Intergenic
1183743756 22:39681840-39681862 GGGAGGGGACCAAAATGACATGG - Intronic
953370354 3:42382624-42382646 TGGAGATGACCAACTTTCCAGGG + Intergenic
954192370 3:48972904-48972926 GGGATCTCACCATATTGCCCAGG + Intronic
954899680 3:54008182-54008204 GGGAGAAGACAAAAGTGCCAAGG - Intergenic
955064052 3:55519595-55519617 GGGACCAGATCAAATTCCCATGG + Intronic
955732991 3:62007089-62007111 GGGAGCTGTTAAAATTCCCAAGG - Intronic
956129652 3:66040874-66040896 AGGAGGTGACCAATTTTCCATGG + Intergenic
957568175 3:81910960-81910982 GGGAGCTCACAAAATTTTCAGGG + Intergenic
961568476 3:127781731-127781753 GGGAGATCTCCAAATTGTCAGGG + Intronic
961646455 3:128395253-128395275 GGGAGCTGACCCACTCCCCATGG - Intronic
964606793 3:158569067-158569089 AGAAGCTGAATAAATTGCCAAGG - Intergenic
964868588 3:161288966-161288988 GGGAGCTGGCAAAGTTACCACGG + Intergenic
978338519 4:107696510-107696532 GGGAGCTGAACACATGGACATGG + Intronic
978782143 4:112567230-112567252 TGGAGCTGACCAGATTGGGATGG + Intronic
981632742 4:146839845-146839867 CTTAGCTGAGCAAATTGCCAGGG - Intronic
981976565 4:150737020-150737042 GGGATCTCACTACATTGCCAAGG - Intronic
982423696 4:155230064-155230086 GGGATCTCACTAAATTGCCTAGG + Intergenic
986087665 5:4467809-4467831 GATAACTGACCAGATTGCCAAGG - Intergenic
987147555 5:15006937-15006959 GGGAGATGACCACAATTCCATGG + Intergenic
989040527 5:37223158-37223180 TGAAGTTTACCAAATTGCCATGG + Intronic
989816067 5:45738876-45738898 GGGATCTCACCAAATTGCCCAGG + Intergenic
998327428 5:141293970-141293992 GGGTGCTGAGCAAGTTTCCATGG - Intergenic
999234286 5:150081161-150081183 AGGAGCTGAGCAAATGACCAGGG - Intronic
999416899 5:151406150-151406172 GGAAGCTGTGCAAACTGCCAGGG - Intergenic
1000210461 5:159102593-159102615 GGAAGGTGACAAAAGTGCCAGGG + Intergenic
1000532570 5:162442001-162442023 GGGTGCTAACCACAGTGCCAAGG + Intergenic
1001158524 5:169293997-169294019 GGGAGCTCAGCACAGTGCCAGGG + Intronic
1003240870 6:4344592-4344614 AGAGGCTGACTAAATTGCCATGG - Intergenic
1003732304 6:8838932-8838954 GGGAGCCGACTGAATTTCCATGG + Intergenic
1005761964 6:28975757-28975779 GGGGTCTCACCAAGTTGCCAAGG + Intergenic
1007557240 6:42776537-42776559 GGGATCTGACCATGTTGCCCAGG + Intronic
1012223770 6:96682557-96682579 GGTGCCTGACAAAATTGCCAAGG - Intergenic
1012729402 6:102862113-102862135 GTGGGCAGACCAGATTGCCAAGG - Intergenic
1013598943 6:111686144-111686166 GGGAGCAGGTCAAATTGGCAGGG - Intronic
1016126224 6:140407733-140407755 TGGTGCTGACCAAAATGCTATGG + Intergenic
1016324785 6:142888316-142888338 GGGGTCTCACCACATTGCCAGGG + Intronic
1017628024 6:156368052-156368074 GGAAGGTCACCAAATAGCCAAGG + Intergenic
1018382405 6:163270563-163270585 GGGATCTCACCATATTGCCCAGG + Intronic
1023317756 7:38957814-38957836 GGGAGCTGTCTAAATAGACATGG - Intergenic
1034828175 7:154286261-154286283 GGAAGCTGATGAAATTGCCCAGG - Intronic
1036530415 8:9580298-9580320 AGGAGCTGATCCAAATGCCAGGG + Exonic
1036628999 8:10497191-10497213 AGGAACTGACCACAATGCCAGGG + Intergenic
1037192029 8:16137798-16137820 GGGATCTCACTATATTGCCAAGG - Intronic
1037950273 8:23014972-23014994 GGGAGCTGACCAAGTGGGGAAGG + Intronic
1047495453 8:125405595-125405617 GGGAGGTGACCAGATGGCCCAGG + Intergenic
1051870658 9:21734197-21734219 GAGAGAAGACCAAATTTCCAAGG - Intergenic
1052076287 9:24144440-24144462 GGGATCTTACCATATTGCCCAGG + Intergenic
1052508856 9:29388913-29388935 GGAATCTGACTATATTGCCAAGG + Intergenic
1056247984 9:84717419-84717441 GAGAGTTGACCAAATTGACTAGG - Intronic
1058862293 9:109128031-109128053 GGTAGCTGACCAAATTCCTTAGG - Intergenic
1060107905 9:120885719-120885741 GGGACCTGACAAAAGTGGCATGG - Intronic
1060506976 9:124205157-124205179 TGGAGATGACGAAACTGCCATGG - Intergenic
1186246831 X:7623787-7623809 GTGAGCTTCCTAAATTGCCAAGG + Intergenic
1187689543 X:21851180-21851202 GGGAGCCCAGCAAAGTGCCAAGG - Intronic
1187942191 X:24392862-24392884 GGGTGCTCACCAAATACCCAGGG - Intergenic
1189363703 X:40371961-40371983 GGGATCTCACCACATTGCCCAGG - Intergenic
1190215168 X:48475120-48475142 GGGATCTCACCATATTGCCCAGG + Intergenic
1192691303 X:73367377-73367399 GAGAGCTGAGCAAAATGCAAGGG - Intergenic
1195480831 X:105342850-105342872 AGTATCAGACCAAATTGCCAGGG - Intronic
1196345727 X:114655289-114655311 GGGATCAGACCAAGTTACCATGG + Intronic
1196602043 X:117612788-117612810 GGGAACTGACCAAGATGCCTAGG + Intergenic
1196750044 X:119107842-119107864 GGGAGCTGAAGATATTGTCAAGG - Intronic
1196826927 X:119748620-119748642 GGGATCTCACCATATTGCCAAGG - Intergenic
1198379160 X:136068105-136068127 GGGAGATGGCCAAACTGGCATGG + Intergenic
1199722718 X:150553743-150553765 TGGAGATGTGCAAATTGCCACGG - Intergenic
1199782124 X:151071299-151071321 GAGAGCTGAGCAAAATGACAAGG - Intergenic
1200829730 Y:7678877-7678899 GGGAGCTGACCCAAGTGTCTAGG + Intergenic