ID: 914009887

View in Genome Browser
Species Human (GRCh38)
Location 1:143767960-143767982
Sequence GAGGAAAACCATAATTGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914009887_914009893 13 Left 914009887 1:143767960-143767982 CCAACCCAATTATGGTTTTCCTC No data
Right 914009893 1:143767996-143768018 CTGTGAAAGCCTTCTTGGTCTGG No data
914009887_914009892 8 Left 914009887 1:143767960-143767982 CCAACCCAATTATGGTTTTCCTC No data
Right 914009892 1:143767991-143768013 TTACGCTGTGAAAGCCTTCTTGG No data
914009887_914009895 26 Left 914009887 1:143767960-143767982 CCAACCCAATTATGGTTTTCCTC No data
Right 914009895 1:143768009-143768031 CTTGGTCTGGACCCTGCAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914009887 Original CRISPR GAGGAAAACCATAATTGGGT TGG (reversed) Intergenic
No off target data available for this crispr