ID: 914011010

View in Genome Browser
Species Human (GRCh38)
Location 1:143777982-143778004
Sequence TGTGGTCACCAGATGATGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914011009_914011010 -6 Left 914011009 1:143777965-143777987 CCATCTTGTCTTGTCTTTGTGGT No data
Right 914011010 1:143777982-143778004 TGTGGTCACCAGATGATGCAAGG No data
914011003_914011010 27 Left 914011003 1:143777932-143777954 CCTGTCCTGTCCTGTGTTATATC No data
Right 914011010 1:143777982-143778004 TGTGGTCACCAGATGATGCAAGG No data
914011006_914011010 0 Left 914011006 1:143777959-143777981 CCTGTCCCATCTTGTCTTGTCTT No data
Right 914011010 1:143777982-143778004 TGTGGTCACCAGATGATGCAAGG No data
914011004_914011010 22 Left 914011004 1:143777937-143777959 CCTGTCCTGTGTTATATCATGTC No data
Right 914011010 1:143777982-143778004 TGTGGTCACCAGATGATGCAAGG No data
914011007_914011010 -5 Left 914011007 1:143777964-143777986 CCCATCTTGTCTTGTCTTTGTGG No data
Right 914011010 1:143777982-143778004 TGTGGTCACCAGATGATGCAAGG No data
914011005_914011010 17 Left 914011005 1:143777942-143777964 CCTGTGTTATATCATGTCCTGTC No data
Right 914011010 1:143777982-143778004 TGTGGTCACCAGATGATGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914011010 Original CRISPR TGTGGTCACCAGATGATGCA AGG Intergenic
No off target data available for this crispr