ID: 914011209

View in Genome Browser
Species Human (GRCh38)
Location 1:143780357-143780379
Sequence GATGCCACACACTGCCATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914011209_914011213 7 Left 914011209 1:143780357-143780379 CCAAAATGGCAGTGTGTGGCATC No data
Right 914011213 1:143780387-143780409 GGAGAAACTGAGCTGTCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914011209 Original CRISPR GATGCCACACACTGCCATTT TGG (reversed) Intergenic
No off target data available for this crispr