ID: 914013478

View in Genome Browser
Species Human (GRCh38)
Location 1:143796367-143796389
Sequence CTCCCATAGCAACCAGGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914013478_914013488 13 Left 914013478 1:143796367-143796389 CCCTGGCCTGGTTGCTATGGGAG No data
Right 914013488 1:143796403-143796425 ATGGAGCCTGAGGCAGGTGTGGG No data
914013478_914013490 22 Left 914013478 1:143796367-143796389 CCCTGGCCTGGTTGCTATGGGAG No data
Right 914013490 1:143796412-143796434 GAGGCAGGTGTGGGAAGATGTGG No data
914013478_914013487 12 Left 914013478 1:143796367-143796389 CCCTGGCCTGGTTGCTATGGGAG No data
Right 914013487 1:143796402-143796424 GATGGAGCCTGAGGCAGGTGTGG No data
914013478_914013484 3 Left 914013478 1:143796367-143796389 CCCTGGCCTGGTTGCTATGGGAG No data
Right 914013484 1:143796393-143796415 CAGTGGCCTGATGGAGCCTGAGG No data
914013478_914013483 -6 Left 914013478 1:143796367-143796389 CCCTGGCCTGGTTGCTATGGGAG No data
Right 914013483 1:143796384-143796406 TGGGAGGCACAGTGGCCTGATGG No data
914013478_914013485 7 Left 914013478 1:143796367-143796389 CCCTGGCCTGGTTGCTATGGGAG No data
Right 914013485 1:143796397-143796419 GGCCTGATGGAGCCTGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914013478 Original CRISPR CTCCCATAGCAACCAGGCCA GGG (reversed) Intergenic
No off target data available for this crispr