ID: 914016933

View in Genome Browser
Species Human (GRCh38)
Location 1:143828259-143828281
Sequence CTGTGATCCAGCTGTTCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914016933_914016942 21 Left 914016933 1:143828259-143828281 CCTCCTGAACAGCTGGATCACAG No data
Right 914016942 1:143828303-143828325 AATTATTGCATTTTTAGTAGAGG No data
914016933_914016945 29 Left 914016933 1:143828259-143828281 CCTCCTGAACAGCTGGATCACAG No data
Right 914016945 1:143828311-143828333 CATTTTTAGTAGAGGCAGGGTGG No data
914016933_914016944 26 Left 914016933 1:143828259-143828281 CCTCCTGAACAGCTGGATCACAG No data
Right 914016944 1:143828308-143828330 TTGCATTTTTAGTAGAGGCAGGG 0: 66
1: 3887
2: 72497
3: 167693
4: 187106
914016933_914016943 25 Left 914016933 1:143828259-143828281 CCTCCTGAACAGCTGGATCACAG No data
Right 914016943 1:143828307-143828329 ATTGCATTTTTAGTAGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914016933 Original CRISPR CTGTGATCCAGCTGTTCAGG AGG (reversed) Intergenic
No off target data available for this crispr