ID: 914016935

View in Genome Browser
Species Human (GRCh38)
Location 1:143828262-143828284
Sequence GGCCTGTGATCCAGCTGTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914016935_914016945 26 Left 914016935 1:143828262-143828284 CCTGAACAGCTGGATCACAGGCC No data
Right 914016945 1:143828311-143828333 CATTTTTAGTAGAGGCAGGGTGG No data
914016935_914016944 23 Left 914016935 1:143828262-143828284 CCTGAACAGCTGGATCACAGGCC No data
Right 914016944 1:143828308-143828330 TTGCATTTTTAGTAGAGGCAGGG 0: 66
1: 3887
2: 72497
3: 167693
4: 187106
914016935_914016943 22 Left 914016935 1:143828262-143828284 CCTGAACAGCTGGATCACAGGCC No data
Right 914016943 1:143828307-143828329 ATTGCATTTTTAGTAGAGGCAGG No data
914016935_914016942 18 Left 914016935 1:143828262-143828284 CCTGAACAGCTGGATCACAGGCC No data
Right 914016942 1:143828303-143828325 AATTATTGCATTTTTAGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914016935 Original CRISPR GGCCTGTGATCCAGCTGTTC AGG (reversed) Intergenic
No off target data available for this crispr