ID: 914016937

View in Genome Browser
Species Human (GRCh38)
Location 1:143828284-143828306
Sequence AATTAGCTGGGCATGGTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 150952
Summary {0: 65, 1: 4381, 2: 21393, 3: 49906, 4: 75207}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914016937_914016947 27 Left 914016937 1:143828284-143828306 CCCACAACCATGCCCAGCTAATT 0: 65
1: 4381
2: 21393
3: 49906
4: 75207
Right 914016947 1:143828334-143828356 TTTCACCATGTCAGTCAGGCTGG 0: 69
1: 1568
2: 27096
3: 162116
4: 229432
914016937_914016943 0 Left 914016937 1:143828284-143828306 CCCACAACCATGCCCAGCTAATT 0: 65
1: 4381
2: 21393
3: 49906
4: 75207
Right 914016943 1:143828307-143828329 ATTGCATTTTTAGTAGAGGCAGG No data
914016937_914016945 4 Left 914016937 1:143828284-143828306 CCCACAACCATGCCCAGCTAATT 0: 65
1: 4381
2: 21393
3: 49906
4: 75207
Right 914016945 1:143828311-143828333 CATTTTTAGTAGAGGCAGGGTGG No data
914016937_914016942 -4 Left 914016937 1:143828284-143828306 CCCACAACCATGCCCAGCTAATT 0: 65
1: 4381
2: 21393
3: 49906
4: 75207
Right 914016942 1:143828303-143828325 AATTATTGCATTTTTAGTAGAGG No data
914016937_914016946 23 Left 914016937 1:143828284-143828306 CCCACAACCATGCCCAGCTAATT 0: 65
1: 4381
2: 21393
3: 49906
4: 75207
Right 914016946 1:143828330-143828352 GTGGTTTCACCATGTCAGTCAGG No data
914016937_914016944 1 Left 914016937 1:143828284-143828306 CCCACAACCATGCCCAGCTAATT 0: 65
1: 4381
2: 21393
3: 49906
4: 75207
Right 914016944 1:143828308-143828330 TTGCATTTTTAGTAGAGGCAGGG 0: 66
1: 3887
2: 72497
3: 167693
4: 187106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914016937 Original CRISPR AATTAGCTGGGCATGGTTGT GGG (reversed) Intergenic
Too many off-targets to display for this crispr