ID: 914016938

View in Genome Browser
Species Human (GRCh38)
Location 1:143828285-143828307
Sequence TAATTAGCTGGGCATGGTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914016938_914016945 3 Left 914016938 1:143828285-143828307 CCACAACCATGCCCAGCTAATTA No data
Right 914016945 1:143828311-143828333 CATTTTTAGTAGAGGCAGGGTGG No data
914016938_914016942 -5 Left 914016938 1:143828285-143828307 CCACAACCATGCCCAGCTAATTA No data
Right 914016942 1:143828303-143828325 AATTATTGCATTTTTAGTAGAGG No data
914016938_914016947 26 Left 914016938 1:143828285-143828307 CCACAACCATGCCCAGCTAATTA No data
Right 914016947 1:143828334-143828356 TTTCACCATGTCAGTCAGGCTGG 0: 69
1: 1568
2: 27096
3: 162116
4: 229432
914016938_914016946 22 Left 914016938 1:143828285-143828307 CCACAACCATGCCCAGCTAATTA No data
Right 914016946 1:143828330-143828352 GTGGTTTCACCATGTCAGTCAGG No data
914016938_914016944 0 Left 914016938 1:143828285-143828307 CCACAACCATGCCCAGCTAATTA No data
Right 914016944 1:143828308-143828330 TTGCATTTTTAGTAGAGGCAGGG 0: 66
1: 3887
2: 72497
3: 167693
4: 187106
914016938_914016943 -1 Left 914016938 1:143828285-143828307 CCACAACCATGCCCAGCTAATTA No data
Right 914016943 1:143828307-143828329 ATTGCATTTTTAGTAGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914016938 Original CRISPR TAATTAGCTGGGCATGGTTG TGG (reversed) Intergenic
No off target data available for this crispr