ID: 914016940

View in Genome Browser
Species Human (GRCh38)
Location 1:143828296-143828318
Sequence TAAAAATGCAATAATTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 302883
Summary {0: 10, 1: 1969, 2: 63663, 3: 133624, 4: 103617}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914016940_914016947 15 Left 914016940 1:143828296-143828318 CCCAGCTAATTATTGCATTTTTA 0: 10
1: 1969
2: 63663
3: 133624
4: 103617
Right 914016947 1:143828334-143828356 TTTCACCATGTCAGTCAGGCTGG 0: 69
1: 1568
2: 27096
3: 162116
4: 229432
914016940_914016946 11 Left 914016940 1:143828296-143828318 CCCAGCTAATTATTGCATTTTTA 0: 10
1: 1969
2: 63663
3: 133624
4: 103617
Right 914016946 1:143828330-143828352 GTGGTTTCACCATGTCAGTCAGG No data
914016940_914016945 -8 Left 914016940 1:143828296-143828318 CCCAGCTAATTATTGCATTTTTA 0: 10
1: 1969
2: 63663
3: 133624
4: 103617
Right 914016945 1:143828311-143828333 CATTTTTAGTAGAGGCAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914016940 Original CRISPR TAAAAATGCAATAATTAGCT GGG (reversed) Intergenic
Too many off-targets to display for this crispr