ID: 914016941

View in Genome Browser
Species Human (GRCh38)
Location 1:143828297-143828319
Sequence CTAAAAATGCAATAATTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 210721
Summary {0: 11, 1: 2708, 2: 88236, 3: 74026, 4: 45740}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914016941_914016947 14 Left 914016941 1:143828297-143828319 CCAGCTAATTATTGCATTTTTAG 0: 11
1: 2708
2: 88236
3: 74026
4: 45740
Right 914016947 1:143828334-143828356 TTTCACCATGTCAGTCAGGCTGG 0: 69
1: 1568
2: 27096
3: 162116
4: 229432
914016941_914016945 -9 Left 914016941 1:143828297-143828319 CCAGCTAATTATTGCATTTTTAG 0: 11
1: 2708
2: 88236
3: 74026
4: 45740
Right 914016945 1:143828311-143828333 CATTTTTAGTAGAGGCAGGGTGG No data
914016941_914016946 10 Left 914016941 1:143828297-143828319 CCAGCTAATTATTGCATTTTTAG 0: 11
1: 2708
2: 88236
3: 74026
4: 45740
Right 914016946 1:143828330-143828352 GTGGTTTCACCATGTCAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914016941 Original CRISPR CTAAAAATGCAATAATTAGC TGG (reversed) Intergenic
Too many off-targets to display for this crispr