ID: 914016941 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:143828297-143828319 |
| Sequence | CTAAAAATGCAATAATTAGC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 210721 | |||
| Summary | {0: 11, 1: 2708, 2: 88236, 3: 74026, 4: 45740} |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 914016941_914016947 | 14 | Left | 914016941 | 1:143828297-143828319 | CCAGCTAATTATTGCATTTTTAG | 0: 11 1: 2708 2: 88236 3: 74026 4: 45740 |
||
| Right | 914016947 | 1:143828334-143828356 | TTTCACCATGTCAGTCAGGCTGG | 0: 69 1: 1568 2: 27096 3: 162116 4: 229432 |
||||
| 914016941_914016945 | -9 | Left | 914016941 | 1:143828297-143828319 | CCAGCTAATTATTGCATTTTTAG | 0: 11 1: 2708 2: 88236 3: 74026 4: 45740 |
||
| Right | 914016945 | 1:143828311-143828333 | CATTTTTAGTAGAGGCAGGGTGG | No data | ||||
| 914016941_914016946 | 10 | Left | 914016941 | 1:143828297-143828319 | CCAGCTAATTATTGCATTTTTAG | 0: 11 1: 2708 2: 88236 3: 74026 4: 45740 |
||
| Right | 914016946 | 1:143828330-143828352 | GTGGTTTCACCATGTCAGTCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 914016941 | Original CRISPR | CTAAAAATGCAATAATTAGC TGG (reversed) | Intergenic | ||
| Too many off-targets to display for this crispr | |||||