ID: 914016945

View in Genome Browser
Species Human (GRCh38)
Location 1:143828311-143828333
Sequence CATTTTTAGTAGAGGCAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914016940_914016945 -8 Left 914016940 1:143828296-143828318 CCCAGCTAATTATTGCATTTTTA 0: 10
1: 1969
2: 63663
3: 133624
4: 103617
Right 914016945 1:143828311-143828333 CATTTTTAGTAGAGGCAGGGTGG No data
914016936_914016945 5 Left 914016936 1:143828283-143828305 CCCCACAACCATGCCCAGCTAAT No data
Right 914016945 1:143828311-143828333 CATTTTTAGTAGAGGCAGGGTGG No data
914016938_914016945 3 Left 914016938 1:143828285-143828307 CCACAACCATGCCCAGCTAATTA No data
Right 914016945 1:143828311-143828333 CATTTTTAGTAGAGGCAGGGTGG No data
914016935_914016945 26 Left 914016935 1:143828262-143828284 CCTGAACAGCTGGATCACAGGCC No data
Right 914016945 1:143828311-143828333 CATTTTTAGTAGAGGCAGGGTGG No data
914016933_914016945 29 Left 914016933 1:143828259-143828281 CCTCCTGAACAGCTGGATCACAG No data
Right 914016945 1:143828311-143828333 CATTTTTAGTAGAGGCAGGGTGG No data
914016941_914016945 -9 Left 914016941 1:143828297-143828319 CCAGCTAATTATTGCATTTTTAG 0: 11
1: 2708
2: 88236
3: 74026
4: 45740
Right 914016945 1:143828311-143828333 CATTTTTAGTAGAGGCAGGGTGG No data
914016939_914016945 -3 Left 914016939 1:143828291-143828313 CCATGCCCAGCTAATTATTGCAT No data
Right 914016945 1:143828311-143828333 CATTTTTAGTAGAGGCAGGGTGG No data
914016937_914016945 4 Left 914016937 1:143828284-143828306 CCCACAACCATGCCCAGCTAATT 0: 65
1: 4381
2: 21393
3: 49906
4: 75207
Right 914016945 1:143828311-143828333 CATTTTTAGTAGAGGCAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914016945 Original CRISPR CATTTTTAGTAGAGGCAGGG TGG Intergenic
No off target data available for this crispr