ID: 914017320

View in Genome Browser
Species Human (GRCh38)
Location 1:143832121-143832143
Sequence CAGAATATACAATCGAACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914017319_914017320 25 Left 914017319 1:143832073-143832095 CCAGGGTGCTCAATTAGGACTTG No data
Right 914017320 1:143832121-143832143 CAGAATATACAATCGAACAATGG No data
914017318_914017320 26 Left 914017318 1:143832072-143832094 CCCAGGGTGCTCAATTAGGACTT No data
Right 914017320 1:143832121-143832143 CAGAATATACAATCGAACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914017320 Original CRISPR CAGAATATACAATCGAACAA TGG Intergenic
No off target data available for this crispr