ID: 914024116

View in Genome Browser
Species Human (GRCh38)
Location 1:143896701-143896723
Sequence CAAGTTATTCCCCTGTAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914024116_914024119 -3 Left 914024116 1:143896701-143896723 CCACCTTACAGGGGAATAACTTG No data
Right 914024119 1:143896721-143896743 TTGAGGATCAATTTGCTGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914024116 Original CRISPR CAAGTTATTCCCCTGTAAGG TGG (reversed) Intergenic
No off target data available for this crispr