ID: 914024187

View in Genome Browser
Species Human (GRCh38)
Location 1:143897518-143897540
Sequence TTGTGCTGTCCCTAATTTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914024185_914024187 -5 Left 914024185 1:143897500-143897522 CCAAATCCTCATTCTGTGTTGTG No data
Right 914024187 1:143897518-143897540 TTGTGCTGTCCCTAATTTAGAGG No data
914024184_914024187 -4 Left 914024184 1:143897499-143897521 CCCAAATCCTCATTCTGTGTTGT No data
Right 914024187 1:143897518-143897540 TTGTGCTGTCCCTAATTTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914024187 Original CRISPR TTGTGCTGTCCCTAATTTAG AGG Intergenic
No off target data available for this crispr