ID: 914024203 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:143897740-143897762 |
| Sequence | AGAATAAGTCCTATGAAGGT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 914024203_914024209 | -8 | Left | 914024203 | 1:143897740-143897762 | CCTACCTTCATAGGACTTATTCT | No data | ||
| Right | 914024209 | 1:143897755-143897777 | CTTATTCTGAGGAGGTAGGAGGG | No data | ||||
| 914024203_914024208 | -9 | Left | 914024203 | 1:143897740-143897762 | CCTACCTTCATAGGACTTATTCT | No data | ||
| Right | 914024208 | 1:143897754-143897776 | ACTTATTCTGAGGAGGTAGGAGG | No data | ||||
| 914024203_914024210 | -7 | Left | 914024203 | 1:143897740-143897762 | CCTACCTTCATAGGACTTATTCT | No data | ||
| Right | 914024210 | 1:143897756-143897778 | TTATTCTGAGGAGGTAGGAGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 914024203 | Original CRISPR | AGAATAAGTCCTATGAAGGT AGG (reversed) | Intergenic | ||