ID: 914024203

View in Genome Browser
Species Human (GRCh38)
Location 1:143897740-143897762
Sequence AGAATAAGTCCTATGAAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914024203_914024209 -8 Left 914024203 1:143897740-143897762 CCTACCTTCATAGGACTTATTCT No data
Right 914024209 1:143897755-143897777 CTTATTCTGAGGAGGTAGGAGGG No data
914024203_914024210 -7 Left 914024203 1:143897740-143897762 CCTACCTTCATAGGACTTATTCT No data
Right 914024210 1:143897756-143897778 TTATTCTGAGGAGGTAGGAGGGG No data
914024203_914024208 -9 Left 914024203 1:143897740-143897762 CCTACCTTCATAGGACTTATTCT No data
Right 914024208 1:143897754-143897776 ACTTATTCTGAGGAGGTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914024203 Original CRISPR AGAATAAGTCCTATGAAGGT AGG (reversed) Intergenic
No off target data available for this crispr