ID: 914024208

View in Genome Browser
Species Human (GRCh38)
Location 1:143897754-143897776
Sequence ACTTATTCTGAGGAGGTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914024203_914024208 -9 Left 914024203 1:143897740-143897762 CCTACCTTCATAGGACTTATTCT No data
Right 914024208 1:143897754-143897776 ACTTATTCTGAGGAGGTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914024208 Original CRISPR ACTTATTCTGAGGAGGTAGG AGG Intergenic