ID: 914024209

View in Genome Browser
Species Human (GRCh38)
Location 1:143897755-143897777
Sequence CTTATTCTGAGGAGGTAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914024203_914024209 -8 Left 914024203 1:143897740-143897762 CCTACCTTCATAGGACTTATTCT No data
Right 914024209 1:143897755-143897777 CTTATTCTGAGGAGGTAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914024209 Original CRISPR CTTATTCTGAGGAGGTAGGA GGG Intergenic