ID: 914024210

View in Genome Browser
Species Human (GRCh38)
Location 1:143897756-143897778
Sequence TTATTCTGAGGAGGTAGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914024203_914024210 -7 Left 914024203 1:143897740-143897762 CCTACCTTCATAGGACTTATTCT No data
Right 914024210 1:143897756-143897778 TTATTCTGAGGAGGTAGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914024210 Original CRISPR TTATTCTGAGGAGGTAGGAG GGG Intergenic