ID: 914024562

View in Genome Browser
Species Human (GRCh38)
Location 1:143901064-143901086
Sequence CTGGGTCAGGGCATTGAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914024562_914024571 12 Left 914024562 1:143901064-143901086 CCAATCTCAATGCCCTGACCCAG No data
Right 914024571 1:143901099-143901121 TCTACATGTGCAGTGTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914024562 Original CRISPR CTGGGTCAGGGCATTGAGAT TGG (reversed) Intergenic
No off target data available for this crispr