ID: 914033414

View in Genome Browser
Species Human (GRCh38)
Location 1:143978591-143978613
Sequence GCCCCAACCCTACCCCAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914033412_914033414 0 Left 914033412 1:143978568-143978590 CCTGAGGAACTCCTGAGGCTTCA No data
Right 914033414 1:143978591-143978613 GCCCCAACCCTACCCCAGAGTGG No data
914033405_914033414 27 Left 914033405 1:143978541-143978563 CCCTATAAACCACCTGCTTGCAT No data
Right 914033414 1:143978591-143978613 GCCCCAACCCTACCCCAGAGTGG No data
914033404_914033414 30 Left 914033404 1:143978538-143978560 CCTCCCTATAAACCACCTGCTTG No data
Right 914033414 1:143978591-143978613 GCCCCAACCCTACCCCAGAGTGG No data
914033406_914033414 26 Left 914033406 1:143978542-143978564 CCTATAAACCACCTGCTTGCATG No data
Right 914033414 1:143978591-143978613 GCCCCAACCCTACCCCAGAGTGG No data
914033409_914033414 15 Left 914033409 1:143978553-143978575 CCTGCTTGCATGTGCCCTGAGGA No data
Right 914033414 1:143978591-143978613 GCCCCAACCCTACCCCAGAGTGG No data
914033407_914033414 18 Left 914033407 1:143978550-143978572 CCACCTGCTTGCATGTGCCCTGA No data
Right 914033414 1:143978591-143978613 GCCCCAACCCTACCCCAGAGTGG No data
914033411_914033414 1 Left 914033411 1:143978567-143978589 CCCTGAGGAACTCCTGAGGCTTC No data
Right 914033414 1:143978591-143978613 GCCCCAACCCTACCCCAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914033414 Original CRISPR GCCCCAACCCTACCCCAGAG TGG Intergenic
No off target data available for this crispr