ID: 914038836

View in Genome Browser
Species Human (GRCh38)
Location 1:144029084-144029106
Sequence TCATAATGAACTTCTGTAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914038836_914038841 9 Left 914038836 1:144029084-144029106 CCCTTTACAGAAGTTCATTATGA No data
Right 914038841 1:144029116-144029138 GATGAAATCAACATTGTAAAGGG No data
914038836_914038844 20 Left 914038836 1:144029084-144029106 CCCTTTACAGAAGTTCATTATGA No data
Right 914038844 1:144029127-144029149 CATTGTAAAGGGAGTAGGGAAGG No data
914038836_914038840 8 Left 914038836 1:144029084-144029106 CCCTTTACAGAAGTTCATTATGA No data
Right 914038840 1:144029115-144029137 GGATGAAATCAACATTGTAAAGG No data
914038836_914038843 16 Left 914038836 1:144029084-144029106 CCCTTTACAGAAGTTCATTATGA No data
Right 914038843 1:144029123-144029145 TCAACATTGTAAAGGGAGTAGGG No data
914038836_914038842 15 Left 914038836 1:144029084-144029106 CCCTTTACAGAAGTTCATTATGA No data
Right 914038842 1:144029122-144029144 ATCAACATTGTAAAGGGAGTAGG No data
914038836_914038845 23 Left 914038836 1:144029084-144029106 CCCTTTACAGAAGTTCATTATGA No data
Right 914038845 1:144029130-144029152 TGTAAAGGGAGTAGGGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914038836 Original CRISPR TCATAATGAACTTCTGTAAA GGG (reversed) Intergenic
No off target data available for this crispr