ID: 914038839

View in Genome Browser
Species Human (GRCh38)
Location 1:144029111-144029133
Sequence TACAATGTTGATTTCATCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914038839_914038844 -7 Left 914038839 1:144029111-144029133 CCAAGGATGAAATCAACATTGTA No data
Right 914038844 1:144029127-144029149 CATTGTAAAGGGAGTAGGGAAGG No data
914038839_914038845 -4 Left 914038839 1:144029111-144029133 CCAAGGATGAAATCAACATTGTA No data
Right 914038845 1:144029130-144029152 TGTAAAGGGAGTAGGGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914038839 Original CRISPR TACAATGTTGATTTCATCCT TGG (reversed) Intergenic
No off target data available for this crispr