ID: 914038842

View in Genome Browser
Species Human (GRCh38)
Location 1:144029122-144029144
Sequence ATCAACATTGTAAAGGGAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914038836_914038842 15 Left 914038836 1:144029084-144029106 CCCTTTACAGAAGTTCATTATGA No data
Right 914038842 1:144029122-144029144 ATCAACATTGTAAAGGGAGTAGG No data
914038835_914038842 16 Left 914038835 1:144029083-144029105 CCCCTTTACAGAAGTTCATTATG No data
Right 914038842 1:144029122-144029144 ATCAACATTGTAAAGGGAGTAGG No data
914038837_914038842 14 Left 914038837 1:144029085-144029107 CCTTTACAGAAGTTCATTATGAA No data
Right 914038842 1:144029122-144029144 ATCAACATTGTAAAGGGAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914038842 Original CRISPR ATCAACATTGTAAAGGGAGT AGG Intergenic
No off target data available for this crispr