ID: 914038844

View in Genome Browser
Species Human (GRCh38)
Location 1:144029127-144029149
Sequence CATTGTAAAGGGAGTAGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914038839_914038844 -7 Left 914038839 1:144029111-144029133 CCAAGGATGAAATCAACATTGTA No data
Right 914038844 1:144029127-144029149 CATTGTAAAGGGAGTAGGGAAGG No data
914038836_914038844 20 Left 914038836 1:144029084-144029106 CCCTTTACAGAAGTTCATTATGA No data
Right 914038844 1:144029127-144029149 CATTGTAAAGGGAGTAGGGAAGG No data
914038837_914038844 19 Left 914038837 1:144029085-144029107 CCTTTACAGAAGTTCATTATGAA No data
Right 914038844 1:144029127-144029149 CATTGTAAAGGGAGTAGGGAAGG No data
914038835_914038844 21 Left 914038835 1:144029083-144029105 CCCCTTTACAGAAGTTCATTATG No data
Right 914038844 1:144029127-144029149 CATTGTAAAGGGAGTAGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914038844 Original CRISPR CATTGTAAAGGGAGTAGGGA AGG Intergenic
No off target data available for this crispr