ID: 914040603

View in Genome Browser
Species Human (GRCh38)
Location 1:144046105-144046127
Sequence GGTCCCTGGTTTGCTGCTAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914040603_914040606 -6 Left 914040603 1:144046105-144046127 CCGTTAGCAGCAAACCAGGGACC No data
Right 914040606 1:144046122-144046144 GGGACCCTGAACTAATGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914040603 Original CRISPR GGTCCCTGGTTTGCTGCTAA CGG (reversed) Intergenic
No off target data available for this crispr