ID: 914045100

View in Genome Browser
Species Human (GRCh38)
Location 1:144084706-144084728
Sequence GTTTCAAAGTAGGATGACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914045100_914045103 -8 Left 914045100 1:144084706-144084728 CCTTTGTCATCCTACTTTGAAAC No data
Right 914045103 1:144084721-144084743 TTTGAAACAATTGACTATTTGGG No data
914045100_914045102 -9 Left 914045100 1:144084706-144084728 CCTTTGTCATCCTACTTTGAAAC No data
Right 914045102 1:144084720-144084742 CTTTGAAACAATTGACTATTTGG No data
914045100_914045105 9 Left 914045100 1:144084706-144084728 CCTTTGTCATCCTACTTTGAAAC No data
Right 914045105 1:144084738-144084760 TTTGGGCCTAGATTGATACAGGG No data
914045100_914045104 8 Left 914045100 1:144084706-144084728 CCTTTGTCATCCTACTTTGAAAC No data
Right 914045104 1:144084737-144084759 ATTTGGGCCTAGATTGATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914045100 Original CRISPR GTTTCAAAGTAGGATGACAA AGG (reversed) Intergenic
No off target data available for this crispr