ID: 914045101

View in Genome Browser
Species Human (GRCh38)
Location 1:144084716-144084738
Sequence ATAGTCAATTGTTTCAAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914045101_914045105 -1 Left 914045101 1:144084716-144084738 CCTACTTTGAAACAATTGACTAT No data
Right 914045105 1:144084738-144084760 TTTGGGCCTAGATTGATACAGGG No data
914045101_914045104 -2 Left 914045101 1:144084716-144084738 CCTACTTTGAAACAATTGACTAT No data
Right 914045104 1:144084737-144084759 ATTTGGGCCTAGATTGATACAGG No data
914045101_914045107 22 Left 914045101 1:144084716-144084738 CCTACTTTGAAACAATTGACTAT No data
Right 914045107 1:144084761-144084783 CTTCAAGTTGATTTTAATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914045101 Original CRISPR ATAGTCAATTGTTTCAAAGT AGG (reversed) Intergenic
No off target data available for this crispr